No category

پایان نامه رایگان با موضوع باکتری، پلاسمید، دمای

محلول کلروفرم- ایزوآمیل الکل (به نسبت 1:24) به عصاره افزوده و پس از 5 دقیقه تکان دادن، به مدت 5 دقیقه در13000 دور در دقیقه سانتریفوژ گردید. پس از انتقال حدود 300 میکرولیتر لایه آبی به یک لوله جدید، دو سوم حجم آن ایزوپروپانول اضافه شد و بعد از نگهداری به مدت 20 دقیقه در دمای ?C20-، محلول به مدت 15 دقیقه در13000 دور در دقیقه سانتریفوژ شد. بعد از حذف ایزوپروپانول، رسوب DNA دو بار با اتانول 70 درصد شستشو و به مدت یک روز در دمای اتاق جهت خشک شدن نگهداری شد و در 80 میکرولیتر آب مقطر سترون حل گردید. این آموده تا زمان استفاده در دمای ?C20- نگهداری شد(Maixner et al., 1995).
3-2- تعیین ترادف نوکلئوتیدی
3-2-1- واکنش زنجیرهای پلیمراز ( PCR )
مواد لازم جهت انجام واکنش PCR در جدول (3-1) آمده است. واکنش PCR با جفت آغازگر اختصاصی P1/P7 (جدول3-2) که بخشی از اپرون ریبوزومی را تکثیر می کند و طبق برنامه ارائه شده در جدول 3-3 انجام شد.
3-2-2- تهیه ژل و انجام الکتروفورز
ژل الکتروفورز به صورت زیر تهیه و برای بررسی نتایج آزمون PCR مورد استفاده قرار گرفت.
یک گرم آگاروز در 100 میلی لیتر بافر TBE (8/10 گرم تریس، 5/5 گرم بوریک اسید، و 73/0 گرم EDTA در 1000 میلی لیتر آب، 3/8=pH) حل و چند دقیقه جوشانده شد. پس از رسیدن دما به 60-50 درجه سانتی گراد، محلول ژل به آرامی درون قالبی که دو طرف آن با چسب مسدود شده بود، ریخته شد.
قبل از انجماد ژل، شانه مخصوص به نحوی در داخل مخلوط فرو برده شد که لایه نازکی از ژل در قسمت‌های زیرین شانه قرار داشته باشد. پس از بستن ژل، چسب‌ها از دو انتهای ژل حذف، شانه به آرامی خارج و ژل همراه قالب خود در محفظه دستگاه الکتروفورز به نحوی قرار داده شد که دو سر آزاد ژل با مخازن بافر در تماس باشد. محفظه الکتروفورز با بافر TBE تا اندازه‌ای پر شد که ارتفاع بافر روی سطح ژل به دو تا سه میلی متر برسد.
چند میکرولیتر از محصول PCR با 3 میکرولیتر رنگ مخلوط و در راهک‌ها ریخته و یک راهک به مارکر اختصاص داده شد. پس از قرار دادن درب محفظه الکتروفورز، ولتاژ در 65 ولت تنظیم و به مدت 1 ساعت الکتروفورز انجام گردید.
پس از اتمام زمان مذکور، رنگ آمیزی با اتیدیوم بروماید صورت گرفت. بعد از رنگبری با آب مقطر، ژل برروی صفحه UV transilluminator مورد بررسی قرار گرفت و با استفاده از دستگاه gel documentation عکسبرداری شد و با کمک مارکرهای مخصوص وزن مولکولی قطعه تکثیر شده اندازه‌گیری شد.
جدول3-1- مواد لازم در واکنش PCR
مقدار مواد در هر واکنش 22 میکرولیتری (میکرولیتر)
نوع ماده
5/0
dNTPs(10mM)
1
Primer P1 (10?M)
1
Primer P7 (10?M)
2
Taq buffer(10
75/0
MgCl2 (50mM)
14
Deionized water
65/2
DNA(suspension)
1/0
Taq DNA polymerase (5u/?l)
3-2-3- جفت آغازگر های مبتنی بر ترادف اپرون ریبوزومی
جهت استفاده از ترادفآغازگرهای موردنظر از مقاله اشنایدر و همکاران(1995)استفاده گردید(جدول 3-2).
جدول3-2 ترادف آغازگر های اختصاصی مورد استفاده در واکنش PCR جهت تکثیر اپرون ریبوزومی
Sequence
Primer name
AAGAGTTTGATCCTGGCTCAGGATT 3´ -´5
P1
´3 CGTCCTTCATCGGCTCTT -´5
P7
جهت استفاده از آغازگر های فوق از برنامه مشخص شده در جدول 3-3 استفاده گردید
جدول3-3- سیکل دمایی واکنش PCR برای جفت آغازگر P1/P7
زمان (دقیقه)
دما(سانتی گراد)
مرحله واکنش
تعداد سیکل
3
93
Initial denaturation
1
1
93
Denaturation
35
1
57
Annealing
3
72
Extension
10
72
Final Extension
1
3-2-4- آزمون چند شکلی طولی قطعات برشی
جهت تشخیص فیتوپلاسمای عامل تورم جوانه ابتدا آزمون PCR-RFLP مورد استفاده قرار گرفت. این آزمون طبق دستور شرکت های سازنده آنزیم های برشی انجام گردید. یک واکنش 20 میکرولیتری شامل 10 میکرولیتر آب مقطر سترون، 2 میکرولیتر بافر به همراه یک یونیت از هرکدام از آنزیم های برشی Alu I، Hinf I، Hae III و Rsa I و 8 میکرولیتر محصول PCR بود. لوله های محتوی این مخلوط به مدت 4 ساعت در دمای 37 درجه سانتی گراد جهت هضم شدن نگه داری گردید. پس از طی شدن زمان ذکر شده محصول حاصل در ژل آگاروز 2 درصد مورد بررسی قرار گرفت.
3-2-5- همسانه سازی (cloning) ‌
از محصول PCR برای همسانه‌سازی وتعیین ترادف استفاده شد. همسانه‌سازی با استفاده از کیت فرمنتازInsT/AClone PCR Product Cloning Kit Fermentas )) به صورت زیر انجام گردید.
3-2-5-1- اتصال محصول PCR به پلاسمید (ligation )
قطعه DNA تکثیر شده براساس دستور العمل شرکت سازنده در داخل پلاسمید pTZ57R/T قرار داده شد. مخلوط پلاسمید و محصول PCR به همراه سایر مواد لازم برای انجام واکنش (جدول3-4 )، به مدت یک شب در دمای ?C22 قرار داده شد.
جدول 3-4- مواد مورد نیاز برای اتصال محصول PCR به پلاسمید pTZ57R/T
مقدار ماده مورد نیاز در هر واکنش 30 میکرولیتری (میکرولیتر)
نوع ماده
3
Plasmid vector PTZ57R/T DNA
4
product PCR
6
(ligation buffer5
1
T4 DNA ligase (5U/?l)
16
deionized water
3-2-5-2- انتقال پلاسمید نوترکیب به باکتری E. coli نژاد DH5
عمل انتقال پلاسمید به باکتری E. coli نژاد DH5با استفاده از کیت TransformAidTM Bacterial Transformation(Fermentas) انجام گرفت.
استفاده از باکتری رشد یافته روی محیط کشت جامد:
مقداری از باکتری E. coli DH5? که در دمای?C60- نگهداری شده بود در محیط جامد LB فاقد آنتی بیوتیک کشت و به مدت یک شب در دمای ?C37 نگهداری شد.
پرگنه رشد کرده در محیط جامد LB، در محیط کشت Cکه دمای آن به ?C37 رسانده شده بود، کشت گردید و به مدت 2 ساعت در دمای ?C37 در دستگاه shaker incubator به هم زده شد.
پس از رشد باکتری در محیط LB مایع، سلول‌های باکتری در لوله‌های 5/1 میلی لیتری با سانتریفوژ کردن در سرعت rpm13000 به مدت 30 ثانیه رسوب داده شدند و رونشین حذف گردید.
مراحل تبدیل (transformation) طبق دستورالعمل کیت انجام شد، به این صورت که با مخلوط کردن 210 میکرولیتر از هر کدام از محلولهای A و B (کیت) محلول تی (T solution) تهیه شد.
300 میکرولیتر از محلول تی به رسوب باکتری اضافه شد و رسوب باکتری به آرامی حل گردید و به مدت 5 دقیقه روی یخ نگهداری شد. سوسپانسیون باکتری با سرعت rpm 13000 به مدت 30 ثانیه سانتریفوژ و رونشین حذف شد. رسوب حاصل در 120 میکرولیتر محلول تی (T solution) حل شده و 5 دقیقه روی یخ قرار داده شد.
5/2 میکرولیتر از مخلوط حاوی پلاسمید نوترکیب (ligation mixture) به لوله اپندورف 5/0 میلی‌لیتری منتقل و به مدت 2 دقیقه روی یخ قرار داده شد. 50 میکرولیتر از سوسپانسیون باکتری بدست آمده در مرحله 7 به این لوله اضافه و به مدت 5 دقیقه روی یخ قرار داده شد.
مخلوط نهایی به کمک میله شیشه‌ای خمیده به آرامی روی محیط کشت LB جامد حاوی آنتی‌بیوتیک آمپی‌سیلین (mg/ml 40)، IPTG (mg/ml 20) و X-gal (mg/ml 20) گسترده و تشتک‌ها بصورت وارونه به مدت یک شب در دمای ?C37 قرار داده شدند.
3-2-5-3- انتخاب پرگنه‌های حاوی پلاسمید نوترکیب (clone selection)
پس از رشد باکتری روی محیط کشت به مدت یک شب و ظهور پرگنه‌های سفید و آبی، پرگنه‌های سفید که حاوی پلاسمید نوترکیب بودند انتخاب شده و با استفاده از آزمون PCR طبق جدول 3-1 (با آغازگرهای اختصاصی همان قطعه همسانه سازی شده) و برنامه مندرج در جدول 3-3 تکثیر شد و نتایج حاصل با الکتروفورز بررسی گردید.
3-2-6-محیط کشت های مورد نیاز برای همسانه سازی
3-2-6-1-محیط کشت مایع (Luria-Bertani) LB (7=pH)
Bactotryptone 1 گرم
Yeast extract 5/0 گرم
NaCl 5/0 گرم
مواد فوق در 100 میلی لیتر آب مقطر حل و اتوکلاو شد و پس از کاهش دمای آن به حدود 55 درجه سانتی‌گراد، µg/ml 100 آمپی سیلین به آن اضافه گردید.
3-2-6-2- محیط کشت جامدLB
محیط مایع LB + Difco-agar 2/1%
بعد از اتوکلاو کردن محیط کشت، برای تهیه محیط کشت حاوی آنتی بیوتیک با کاهش دمای آن به حدود 55 درجه سانتیگراد، µg/ml 100 آمپی سیلین، µg/ml 20 از X-gal (حل شده در dimethylformamide) و µg/ml 20 از IPTG اضافه شد.
3-3- تعیین ترادف و مقایسه با بانک ژن
پس از تأیید صحت قطعه همسانه سازی شده باکتری حاوی پلاسمید انتخاب و مجدداً کشت داده شد و پلاسمید آن با استفاده از High Pure Plasmid Isolation Kit (Roche) طبق دستور العمل شرکت سازنده استخراج گردید و با بکارگیری آغازگر های اختصاصی مجدداً مورد بررسی قرار گرفت. پلاسمید استخراج شده با استفاده از دستگاه نانو دراپ به غلظت مورد نظر رسید (طبق دستور شرکت تعیین ترادف کننده) به منظور تعیین ترادف به شرکت Macrogen کشور کره جنوبی ارسال گردید. ترادفهای بدست آمده با استفاده از برنامهBlast با ترادف‌های موجود در GenBank مقایسه شدند و ارتباط آنها با شبه جنس فیتوپلاسما تأیید گردید. سپس با تعدادی از ترادف‌های فیتوپلاسماها در بانک ژن (GenBank) با روش Clustal W و بکارگیری برنامه MEGA5 مقایسه چند ردیفی صورت گرفت و دندروگرام با روش Maximum Likelihood ترسیم شد.

مطلب مشابه :  منابع و ماخذ تحقیقتجارت آزاد، توسعه صادرات، موافقتنامه تجارت آزاد

دیدگاهتان را بنویسید